Biologia delle comunicazioni volume 6, numero articolo: 646 (2023) Citare questo articolo
896 accessi
22 Altmetrico
Dettagli sulle metriche
Il controllo chimico delle zanzare portatrici di malattie Aedes albopictus e Aedes a Egypti è costoso, insostenibile e sempre più inefficace a causa della diffusione della resistenza agli insetticidi. La tecnica dell’insetto sterile è una valida alternativa ma è limitata da metodi di separazione sessuale lenti, soggetti a errori e dispendiosi. Qui presentiamo quattro ceppi di sessaggio genetico (due per ciascuna specie di Aedes) basati su marcatori di fluorescenza collegati ai loci sessuali m e M, consentendo l'isolamento di maschi transgenici. Inoltre, dimostriamo come la combinazione di questi ceppi di sessaggio consenta la produzione di maschi non transgenici. In un impianto di allevamento di massa, 100.000 larve maschili del primo stadio potrebbero essere selezionate in meno di 1,5 ore con una contaminazione femminile stimata dello 0,01-0,1% su una singola macchina. Le analisi di efficienza dei costi hanno rivelato che l'utilizzo di questi ceppi potrebbe comportare notevoli risparmi durante la creazione e la gestione di un impianto di allevamento di massa. Nel complesso, questi ceppi genetici di sessaggio dovrebbero consentire un notevole miglioramento dei programmi di controllo contro questi importanti vettori.
Aedes a Egypti e Aedes albopictus sono specie di zanzare invasive responsabili della trasmissione di numerosi agenti patogeni tra cui i virus dengue (DENV), chikungunya (CHIKV), Zika (ZIKV) e febbre gialla (YFV)1,2. Spinti dai cambiamenti climatici e dal commercio mondiale, entrambi i vettori si stanno diffondendo rapidamente e si prevede che il 49% della popolazione mondiale sarà a rischio di malattie trasmesse da Aedes entro il 2050 in assenza di misure di controllo efficaci3,4.
La soppressione delle popolazioni di zanzare mediante il controllo genetico è una delle alternative più efficaci, sostenibili e rispettose dell’ambiente all’uso degli insetticidi. Si basa su ripetuti rilasci di massa di zanzare maschi che non pungono: sterili (la tecnica dell'insetto sterile, SIT5 e i suoi derivati incluso pgSIT6), infetti da Wolbachia (la tecnica dell'insetto incompatibile, IIT7,8,9), entrambi10,11 o portatori di un transgene letale (Release of Insectschanging a Dominant Lethal, RIDL)12. Per tutti questi interventi è necessario un metodo efficiente di separazione dei sessi. Attualmente, il sesso delle zanzare Aedes viene effettuato in base al dimorfismo naturale delle dimensioni della pupa utilizzando una selezionatrice di Hoch, che può essere completamente manuale13,14 o parzialmente automatizzata11. Questo metodo, che richiede dimensioni pupali omogenee e quindi condizioni di allevamento larvale ottimizzate per la densità, soffre di tassi di contaminazione femminile compresi tra 0,8 e 1% e di un'elevata variabilità giornaliera e da utente a utente15. In particolare, è stata recentemente descritta una selezionatrice pupa e adulta a più fasi che ha consentito una contaminazione femminile di 1,13 × 10−7%9. Tuttavia, questo sistema, come tutti gli altri metodi esistenti, condivide lo svantaggio di una cernita tardiva e di recuperare meno della metà dei maschi allevati14, il che significa che più del 75% delle pupe totali vengono allevate e nutrite invano.
Nelle zanzare Anopheles sono stati descritti ceppi di sessaggio genetico transgenico (GSS) che consentono la separazione automatizzata del sesso delle giovani larve16,17,18,19. I marcatori fluorescenti mostrano un'espressione specifica per il maschio, utilizzando sequenze regolatrici specifiche per il maschio o collegando i marcatori al cromosoma Y. Un ceppo di sessaggio di Anopheles coluzzii è legato all'X20, rendendo le femmine più fluorescenti dei maschi. La separazione del sesso viene eseguita utilizzando un dispositivo COPAS ( Complex Object Parametric Analyser and Sorter ), che funziona come un citometro a flusso, classificando le particelle di grandi dimensioni in base alla loro fluorescenza. Inoltre, come alternativa al rilascio di maschi transgenici, è stato proposto uno schema di incrocio che genera popolazioni di soli maschi non transgenici utilizzando COPAS21. Questo schema richiede un ceppo che porti un marcatore di fluorescenza sul cromosoma Y e un altro che porti un marcatore di fluorescenza sul cromosoma X. L'incrocio di femmine non transgeniche (X−/X−) del primo ceppo con maschi transgenici (X+/Y−) del secondo dà come risultato una progenie composta da femmine transgeniche (X+/X−) e femmine non transgeniche (X−/Y −) maschi.
120 piggyBac random insertions (Fig. 1d). The best m-linked insertion line that we obtained showed a recombination frequency of 0.1%. Its transgenic cassette harboured a Cas9 transgene associated with a DsRed fluorescence marker and was flanked by lox sites. A Cas9 transgene being undesirable in a sexing strain, we excised it using CRE recombinase and replaced it with an eGFP transgene. This Ae. albopictus m-linked strain was termed Aal-m. Sequencing of the transposon’s flanking genomic sequence indicated that it had landed into a highly repeated region; hence, its exact genomic location could not be identified but matched several loci in 1q31 (see Methods and Supplementary Data 1). Both Ae. albopictus transgenic lines show a clear sex-separation pattern in COPAS analyses (Fig. 1c, d). All four lines were fluorescence-sorted and screened at each generation. In the Aaeg-M line, a single recombination event was visually recorded after 15 generations (>10,000 individuals screened in total). Consequently, we estimated that the Aaeg-M and Aaeg-m lines recombine at approximately 0.01%. In Aal-M, four recombinant individuals were observed in the tenth generation after successively screening a total of >50,000 individuals. These recombinations are likely to have arisen from a single event, suggesting that recombination is extremely rare in the Aal-M strain as well./p>$50,000 savings at 20 M males/week and above, Fig. 5e). In total, considering construction, equipment, diet and consumable costs, GSS is predicted to be the most economical option at all tested throughputs, while GSS-CS starts to be more economical compared to manual sorting of pupae from a 10 M males/week throughput (Fig. 5f). Moreover, the workload, the cost of which can only be estimated on a country-by-country basis, is reduced by 29–38% with GSS and 18–27% with GSS-CS (Fig. 5g). For all comparisons, including equipment cost, the most expensive option is the automated sorting of pupae, as the devices are expensive (e.g. $40k for the automated sorter from11, J. Bouyer) and the number of insects to be reared is high (Fig. 5b–g)./p>20,000 screened larvae), we later injected the repair donor plasmid (190 ng/µL) with 5 µM Scr7 and three plasmids expressing different gRNAs under the control of different AeU6 promoters (70 ng/µL each plasmid). This method gave significantly higher knock-in rates (25 GFP positive larvae out of about 4000 screened)./p>20,000 G1 larvae screened, a single transgenic male larva was found, raised to adulthood, and crossed to WT females. Its progeny was composed of 100% eGFP positive sons and 100% eGFP negative daughters, indicative of M linkage. We termed this Ae. aegypti M-linked strain Aaeg-M. Upon injection of 600 BgR9 eggs with the pX3 repair plasmid and a mixture of three plasmids expressing gRNAs (GTGGCATAGCGCCGTGTGGA[GGG], GTCTTAAATGAAAGAGGCG[AGG], GTATCATGCGTATTGCGAG[AGG], brackets indicate the PAM) under the control of three different U6 promoters (gRNA cloning vectors: Supplementary Data 4), 43 larvae with transient eGFP expression were recovered in G0. Resulting 20 males and 20 females were crossed en masse to adults of the opposite sex. 25 transgenic G1 larvae were obtained, 10 of which were males carrying an M-linked insertion, 4 were males carrying an m-linked insertion and 11 were females carrying an m-linked insertion. Proper insertion site in AAEL019619 was confirmed by PCR in all tested individuals, which revealed that in some of these mosquitoes the whole repair plasmid had integrated. From a single male devoid of the plasmid backbone, an Ae. aegypti m-linked strain named Aaeg-m was established and further characterized. Both Aaeg-M and Aaeg-m lines were backcrossed into a Brazilian (Bra) genetic background for 7 generations./p>700 individuals screened in each line until the sixth generation (Supplementary Table 3). Most other M-linked lines also showed 100% fluorescent males but contained additional, non-M-linked multiple insertions and were discarded. Based on line fitness and COPAS profiles, we selected a YFP line termed Aal-M for further work as an Ae. albopictus M-linked strain. Additional M-linked lines marked with OpIE2-GFP or Pub-DsRed showing no recombination to date, carrying a docking attP site for subsequent transgenesis, and representing additional GSSs are also being maintained to date but were not further characterized in detail./p>120 random piggyBac insertions. For this, we screened our existing collection of Ae. albopictus transgenic lines for m/M-linkage and constructed an additional library of piggyBac constructs expressing various fluorescence proteins (eGFP, mTurquoise2, YFP or DsRed) under the control of promoters showing distinct expression patterns (3xP3, OpIE2, Ae. aegypti PUb, Drosophila melanogaster actin5C). By performing multiplex injections of these piggyBac plasmids together, we obtained lines carrying up to six distinct insertions as indicated by their colours and patterns of fluorescence. Out of 40 independent founder transgenic individuals screened (most of which carrying multiple insertions), only two insertions appeared m-linked: one carried an OpIE2-mTurquoise2 marker gene with a recombination rate of about 3%, and the other, called m-albR9, carried a Cas9 transgene with a DsRed reporter gene and showed a recombination rate of 0.1%. We exploited the latter, in which transgenes are flanked by two lox sites adjacent to an attP docking site. We injected m-albR9 eggs with a plasmid encoding Cre recombinase to excise Cas9 and DsRed transgenes, as Cas9 is undesirable in a GSS. From successfully excised individuals, we established an m-linked attP docking line, mX1, carrying no further transgene. In a second step, an attB-containing plasmid carrying a PUb-eGFP marker cassette was integrated into the attP site. The m-linkage of this new strain was verified by crossing eGFP males to WT females and screening their offspring. The new Ae. albopictus m-linked line, named Aal-m was made hemi/homozygous and amplified./p>
Italiano
English
Français
Deutsch
Español
Português
日本語
한국어
Русский